MSH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

MSH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2805 bp
Description
Full length Clone DNA of Human mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MSH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

COCA1 cDNA ORF Clone, Human; FCC1 cDNA ORF Clone, Human; HNPCC cDNA ORF Clone, Human; HNPCC1 cDNA ORF Clone, Human; LCFS2 cDNA ORF Clone, Human

MSH2 Background Information

MSH2 is a key DNA mismatch repair protein, which plays an important role in genomic stability. In addition to its DNA repair function, MSH2 serves as a sensor for DNA base analogs-provoked DNA replication errors and binds to various DNA damage-induced adducts to trigger cell cycle arrest or apoptosis. Loss or depletion of MSH2 from cells renders resistance to certain DNA-damaging agents. Therefore, the level of MSH2 determines DNA damage response.MSH2 is a central component of the mismatch repair pathway that targets mismatches arising during DNA replication, homologous recombination (HR) and in response to genotoxic stresses.MSH2 rearrangements are involved in approximately 1% of hereditary non-polyposis colorectal cancer (HNPCC) families, and in most of the rearrangements, exon 1 is deleted.Loss of human MSH2 (hMSH2) protein might be involved in the multistep pathogenesis of haematological malignancies associated with genetic instability.
Full Name
mutS homolog 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait