MPZL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

MPZL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Human myelin protein zero-like 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MPZL3 Background Information

MPZL3 was essential for normal differentiation, acting downstream of p63, ZNF75, KLF4, and RCOR1, each of which bound near the MPZL3 gene and controlled its expression. MPZL3 protein localized to mitochondria, where it interacted with FDXR, which was itself also found to be essential for differentiation.Together, MPZL3 and FDXR increased reactive oxygen species (ROS) to drive epidermal differentiation. ROS-induced differentiation is dependent upon promotion of FDXR enzymatic activity by MPZL3. ROS induction by the MPZL3 and FDXR mitochondrial proteins is therefore essential for epidermal differentiation.
Full Name
myelin protein zero-like 3
Add to Cart Successfully Add to Cart Failed