Schnelle Bestellung

Mensch MFAP4 Gene ORF cDNA clone expression plasmid

  • Human MFAP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch MFAP4 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_002404.1
cDNA-Größe:768bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens microfibrillar-associated protein 4.
Synonyme für Gene:MFAP4
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-MFAP4
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 0.77kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MFAP4 qPCR primers for gene expression analysis, HP101100 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch MFAP4 Gene Plasmid Map
Human MFAP4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Katalog: HG11195-UT
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“