METTL7B cDNA ORF Clone, Human, N-His tag

Cat: HG16455-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All METTL7B Reagents

CRO Services

Product recommended


All METTL7B Reagents

METTL7B cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human methyltransferase like 7B with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METTL7B cDNA ORF Clone, Human, N-His tag Alternative Names

ALDI cDNA ORF Clone, Human

METTL7B Background Information

Full Name
methyltransferase like 7B

METTL7B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
METTL7B cDNA ORF Clone in Cloning Vector, Mouse MG53906-U
METTL7B cDNA ORF Clone, Mouse, untagged MG53906-UT
METTL7B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53906-ACGLN
METTL7B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53906-ACG
METTL7B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53906-ACR
METTL7B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53906-CF
METTL7B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53906-NF
METTL7B cDNA ORF Clone, Mouse, C-His tag MG53906-CH
METTL7B cDNA ORF Clone, Mouse, N-His tag MG53906-NH
METTL7B cDNA ORF Clone, Mouse, C-HA tag MG53906-CY
METTL7B cDNA ORF Clone, Mouse, N-HA tag MG53906-NY
METTL7B cDNA ORF Clone, Mouse, C-Myc tag MG53906-CM
METTL7B cDNA ORF Clone, Mouse, N-Myc tag MG53906-NM

METTL7B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
METTL7B cDNA ORF Clone in Cloning Vector, Human HG16455-G
METTL7B cDNA ORF Clone, Human, untagged HG16455-UT
METTL7B cDNA ORF Clone, Human, C-GFPSpark® tag HG16455-ACG
METTL7B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16455-ACGLN
METTL7B cDNA ORF Clone, Human, C-OFPSpark® tag HG16455-ACR
METTL7B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16455-CF
METTL7B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16455-NF
METTL7B cDNA ORF Clone, Human, C-His tag HG16455-CH
METTL7B cDNA ORF Clone, Human, C-HA tag HG16455-CY
METTL7B cDNA ORF Clone, Human, N-HA tag HG16455-NY
METTL7B cDNA ORF Clone, Human, C-Myc tag HG16455-CM
METTL7B cDNA ORF Clone, Human, N-Myc tag HG16455-NM
METTL7B qPCR Primer Pairs, Human HP105201
info info
添加购物车成功! 添加购物车失败!