After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human MBP Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001025090.1
cDNA-Größe:516bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens Myelin basic protein, transcript variant 3 with N terminal HA tag.
Synonyme für Gene:MGC99675, MBP
Spezies:Human
Vektor:pCMV3-SP-N-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11167-ACG$225
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11167-ACR$225
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11167-CF$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tagHG11167-CH$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11167-CM$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG11167-CY$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone in cloning vectorHG11167-M$75
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11167-M-F$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmidHG11167-M-N$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11167-NF$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tagHG11167-NH$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11167-NM$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG11167-NY$195
Mensch MBP/Myelin Basic Protein transcript variant 3 Gene ORF cDNA clone expression plasmidHG11167-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: HG11167-NY
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“