LSM6 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

LSM6 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
243 bp
Description
Full length Clone DNA of Human LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LSM6 cDNA ORF Clone, Human, C-His tag: Alternative Names

YDR378C cDNA ORF Clone, Human

LSM6 Background Information

Full Name
LSM6 homolog, U6 small nuclear RNA and mRNA degradation associated
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait