ILT4 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

ILT4 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1797 bp
Description
Full length Clone DNA of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ILT4 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

CD85D cDNA ORF Clone, Human; ILT-4 cDNA ORF Clone, Human; ILT4 cDNA ORF Clone, Human; LIR-2 cDNA ORF Clone, Human; LIR2 cDNA ORF Clone, Human; MIR-10 cDNA ORF Clone, Human; MIR10 cDNA ORF Clone, Human

ILT4 Background Information

ILT4, also known as LILRB2, is a member of the the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). ILT4 gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. Multiple transcript variants encoding different isoforms have been found for ILT4 gene. ILT4 is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity.
Full Name
leukocyte immunoglobulin like receptor B2
References
  • Colonna M., et al.,(1997), A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 186:1809-1818.
  • Borges L., et al., (1997), A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules.J. Immunol. 159:5192-5196.
  • Grimwood J., et al.,(2004), The DNA sequence and biology of human chromosome 19.Nature 428:529-535.
Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后