Schnelle Bestellung

Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5612
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch LGALS9 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_002308.3
cDNA-Größe:1014 bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 9, transcript variant 2 with C terminal HA tag.
Synonyme für Gene:HUAT, LGALS9A, MGC117375, MGC125973, MGC125974, LGALS9
Spezies:Human
Vektor:pCMV3-C-HA
Plasmid:pCMV3-LGALS9-HA
Restriktionsschnittstelle:KpnI + XbaI(6kb+1.01kb)
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with LGALS9 qPCR primers for gene expression analysis, HP101056 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11147-ACG$225
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11147-ACR$225
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11147-ANG$225
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11147-ANR$225
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11147-CF$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG11147-CH$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11147-CM$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG11147-CY$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG11147-M$75
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG11147-M-H$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11147-NF$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG11147-NH$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11147-NM$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG11147-NY$195
Mensch Galectin-9/LGALS9 transcript variant 2 Gene ORF cDNA clone expression plasmidHG11147-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The protein encoded by this gene is an S-type lectin. It is overexpressed in Hodgkin's disease tissue and might participate in the interaction between the H&RS cells with their surrounding cells and might thus play a role in the pathogenesis of this disease and/or its associated immunodeficiency. Multiple alternatively spliced transcript variants have been found for this gene.

Immune Checkpoint
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Size / Price
Katalog: HG11147-CY
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag

Datasheet & Documentation

Contact Us
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“