After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human LGALS14 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_020129.2
cDNA-Größe:420bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 14, transcript variant 1 with N terminal His tag.
Synonyme für Gene:CLC2, PPL13, MGC22235, LGALS14
Spezies:Human
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11371-ACG$225
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11371-ACR$225
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11371-ANG$225
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11371-ANR$225
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11371-CF$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG11371-CH$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11371-CM$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG11371-CY$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG11371-M$75
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11371-M-F$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11371-NF$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG11371-NH$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11371-NM$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG11371-NY$195
Mensch Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmidHG11371-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: HG11371-NH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“