Schnelle Bestellung

Mensch CD18/Integrin beta 2/ITGB2 Gene ORF cDNA clone expression plasmid, C-Flag tag

  • Human Integrin beta2 ORF mammalian expression plasmid, C-Flag tag
  • Human Integrin beta2 natural ORF mammalian expression plasmid, C-Flag tag
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch ITGB2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000211.3
cDNA-Größe:2310bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) with C terminal Flag tag.
Synonyme für Gene:LAD, CD18, MF17, MFI7, LCAMB, LFA-1, MAC-1
Spezies:Human
Vektor:pCMV3-C-FLAG
Plasmid:pCMV3-ITGB2-Flag
Restriktionsschnittstelle:KpnI + XbaI (6kb + 2.35kb)
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 24 G>T, 819 G>A and 1323 T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB2 qPCR primers for gene expression analysis, HP100844 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch ITGB2 Gene Plasmid Map
Human Integrin beta2 natural ORF mammalian expression plasmid, C-Flag tag
Mensch ITGB2 Gene Expression validated Image
Human Integrin beta2 ORF mammalian expression plasmid, C-Flag tag
[Klicken Sie, um das Bild zu vergrößern]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Hintergrund

Integrins form a family of heterodimeric transmembrane receptors that regulate cell–adhesion and cell-extracellular matrix interactions. Lymphocyte function-associated antigen 1 (LFA-1, αLβ2) is a leukocyte specific integrin that mediates firm arrest of leukocytes on the endothelium during migration and establishes cell-cell contacts such as the immunological synapse between DCs and T cells. At the molecular level, transient modifications of adhesion are accomplished by conformational changes of LFA-1 from a bent down inactive to an upright active conformation with an open headpiece, leading to low- and high-affinity for its major ligand ICAM-1 respectively.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referenzen
  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.
  • Size / Price
    Katalog: HG10970-CF
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“