IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Description
Full length Clone DNA of Human interleukin 8 receptor, beta with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL8Rb/CXCR2/CD182 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CD182 cDNA ORF Clone, Human; CDw128b cDNA ORF Clone, Human; CMKAR2 cDNA ORF Clone, Human; IL8R2 cDNA ORF Clone, Human; IL8RA cDNA ORF Clone, Human; IL8RB cDNA ORF Clone, Human

IL8Rb/CXCR2/CD182 Background Information

Full Name
chemokine (C-X-C motif) receptor 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait