After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch IkB alpha/NFKBIA Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human NFKBIA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_020529
cDNA-Größe:954bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha with C terminal His tag.
Synonyme für Gene:IKBA, MAD-3, IkappaBalpha
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkB alpha, NFKBIA, or IKBA), is a member of the NF-kappa-B inhibitor family that function to inhibit the NF-kB transcription factor. NFKBIA inhibits NF-kB by masking the nuclear localization signals (NLS) of NF-kB proteins and keeping them sequestered in an inactive state in the cytoplasm. In addition, NFKBIA blocks the ability of NF-κB transcription factors to bind to DNA, which is required for NF-kB's proper functioning. Signal-induced degradation of I kappa B alpha exposes the nuclear localization signal of NF-kappa B, thus allowing it to translocate into the nucleus and activate transcription from responsive genes. An autoregulatory loop is established when NF-kappa B induces expression of the I kappa B alpha gene and newly synthesized I kappa B alpha accumulates in the nucleus where it negatively regulates NF-kappa B-dependent transcription. As part of this post-induction repression, the nuclear export signal on I kappa B alpha mediates transport of NF-kappa B-I kappa B alpha complexes from the nucleus to the cytoplasm. Deletion of NFKBIA has an effect that is similar to the effect of EGFR amplification in the pathogenesis of glioblastoma and is associated with comparatively short survival. Polymorphisms in NFKBIA may be important in pre-disposition to and outcome after treatment, of multiple myeloma (MM). The NFKBIA gene product, IkappaBalpha, binds to NF-kappaB preventing its activation and is important in mediating resistance to apoptosis in B-cell lymphoproliferative diseases.

Referenzen
  • Verma IM, et al. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev. 9 (22): 2723-35.
  • Jacobs MD, et al. (1998) Structure of an IkappaBalpha/NF-kappaB complex. Cell 95 (6): 749-58.
  • Hay RT, et al. (1999) Control of NF-kappa B transcriptional activation by signal induced proteolysis of I kappa B alpha. Philos Trans R Soc Lond B Biol Sci. 354(1389): 1601-9.
  • Spink CF, et al. (2007) Haplotypic structure across the I kappa B alpha gene (NFKBIA) and association with multiple myeloma. Cancer Lett. 246(1-2): 92-9.
  • Bredel M, et al. (2011) NFKBIA deletion in glioblastomas. N Engl J Med. 364(7): 627-37.
  • Size / Price
    Katalog: HG12045-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“