Schnelle Bestellung

Mensch MDA5/IFIH1 Gene ORF cDNA clone expression plasmid, N-His tag

  • Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch IFIH1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC046208
cDNA-Größe:711 bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens interferon induced with helicase C domain 1 with N terminal His tag.
Synonyme für Gene:Hlcd, MDA5, MDA-5, RLR-2, IDDM19
Spezies:Human
Vektor:pCMV3-N-His
Plasmid:pCMV3-His-IFIH1
Restriktionsschnittstelle:KpnI + XbaI(6kb+0.71kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IFIH1 qPCR primers for gene expression analysis, HP104013 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Katalog: HG15389-NH
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

Contact Us
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“