Schnelle Bestellung

Mensch Insulysin/insulin-degrading enzyme Gene ORF cDNA clone expression plasmid, N-His tag

  • Human Insulysin/insulin-degrading enzyme Gene Plasmid Map 15908
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch IDE Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC096336
cDNA-Größe:3105 bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens insulin-degrading enzyme with N terminal His tag.
Synonyme für Gene:INSULYSIN
Spezies:Human
Vektor:pCMV3-N-His
Plasmid:pCMV3-His-IDE
Restriktionsschnittstelle:KpnI(two restriction sites) + XbaI(6kb+3.06kb+0.06kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IDE qPCR primers for gene expression analysis, HP104565 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“