ORP150 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11342-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ORP150 Reagents
CRO Services
Product recommended

All ORP150 Reagents
ORP150 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3000 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2235A>G not causing the amino acid variation.
Description
Full length Clone DNA of Human hypoxia up-regulated 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + NotI (6kb + 3.04kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ORP150 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ORP150 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human STAT3 Gene Plasmid Map 5680
ORP150 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
GRP-170 cDNA ORF Clone, Human;Grp170 cDNA ORF Clone, Human;HSP12A cDNA ORF Clone, Human;ORP-150 cDNA ORF Clone, Human;ORP150 cDNA ORF Clone, Human
ORP150 Background Information

Hypoxia up-regulated protein 1, also known as 150 kDa oxygen-regulated protein, 170 kDa glucose-regulated protein, ORP-150, GRP-170 and HYOU1, is a member of the heat shock protein 70 family. Seven members from four different heat shock protein (HSP) families were identified including HYOU1 (ORP150), HSPC1 (HSP86), HSPA5 (Bip), HSPD1 (HSP60), and several isoforms of the two testis-specific HSP70 chaperones HSPA2 and HSPA1L. HYOU1 is highly expressed in tissues that contain well-developed endoplasmic reticulum and synthesize large amounts of secretory proteins. It is highly expressed in liver and pancreas. HYOU1 is also expressed in macrophages within aortic atherosclerotic plaques, and in breast cancers. HYOU1 has a pivotal role in cytoprotective cellular mechanisms triggered by oxygen deprivation. It may play a role as a molecular chaperone and participate in protein folding. Suppression of HYOU1 is associated with accelerated apoptosis. It is suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness.

Full Name
hypoxia up-regulated 1
References
  • Ikeda J., et al.,(1997), Cloning and expression of cDNA encoding the human 150 kDa oxygen-regulated protein, ORP150. Biochem. Biophys. Res. Commun. 230:94-99.
  • Kaneda S., et al., (2000), Production of three distinct mRNAs of 150 kDa oxygen-regulated protein (ORP150) by alternative promoters: preferential induction of one species under stress conditions.J. Biochem. 128:529-538.
  • Takeuchi S., (2006), Molecular cloning, sequence, function and structural basis of human heart 150 kDa oxygen-regulated protein, an ER chaperone.Protein J. 25:517-528.
  • info info
    添加购物车成功! 添加购物车失败!