Schnelle Bestellung

Mensch HTR4/5-HT4 Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch HTR4 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001040169.1
cDNA-Größe:1164bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens 5-hydroxytryptamine (serotonin) receptor 4 with N terminal His tag.
Synonyme für Gene:5-HT4, 5-HT4R, HTR4
Spezies:Human
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HTR4 qPCR primers for gene expression analysis, HP100897 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Katalog: HG10753-NH
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“