Schnelle Bestellung

Mensch HSPB8/Cryac Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch HSPB8 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_014365.2
cDNA-Größe:591bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens heat shock 22kDa protein 8.
Synonyme für Gene:H11, HMN2, CMT2L, DHMN2, E2IG1, HMN2A, HSP22, HSPB8
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-HSPB8
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 0.59kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HSPB8 qPCR primers for gene expression analysis, HP100633 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch HSPB8 Gene Plasmid Map
Human HSPB8 / Cryac Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Katalog: HG10666-UT
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
  • Human HSPB8 / Cryac Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“