HSF1 cDNA ORF Clone, Human, C-HA tag

Cat: HG12245-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All HSF1 Reagents

CRO Services

Product recommended


All HSF1 Reagents

HSF1 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1590 bp
Description
Full length Clone DNA of Human heat shock transcription factor 1 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSF1 cDNA ORF Clone, Human, C-HA tag Alternative Names

HSTF1 cDNA ORF Clone, Human

HSF1 Background Information

Heat shock factor protein 1, also known as heat shock transcription factor 1, HSF1 and HSTF1, is a cytoplasm and nucleus protein which belongs to the HSF family. HSF1 is the major transcription factor of HSPs (heat shock proteins) in response to various stresses. Wild type HSF1 (heat shock transcriptional factor 1) is normally inactive. HSF1 / HSTF1 is a DNA-binding protein that specifically binds heat shock promoter elements (HSE) and activates transcription. In higher eukaryotes, HSF is unable to bind to the HSE unless the cells are heat shocked. HSF1 / HSTF1 protects cells and organisms against various types of stress, either by triggering a complex response that promotes cell survival or by triggering cell death when stress-induced alterations cannot be rescued. HSF1 / HSTF1 is the key protein in regulating stress response. It can be activated under heat, oxidative or another stress conditions. Dominant-positive and dominant-negative HSF1 are two types of HSF1 mutants. Both of them gain the DNA binding activity in the absence of stress. In addition, dominant-positive HSF1 acquires transcriptional activity, which dominant-negative HSF1 does not acquire. HSF1 / HSTF1 was also reported to contribute to cell resistance against genotoxic stress, such as that caused by doxorubicin, an anticancer drug in common clinical use.

Full Name
heat shock transcription factor 1
References
  • Holmberg,C.I. et al., 2000, Cell Stress Chaperones.5 (3):219-28.
  • Huang,Y.H. et al., 2007, Sheng Wu Gong Cheng Xue Bao. 23 (6): 971-5.
  • Salmand,P.A. et al.,2008, Biol Reprod  79 (6): 1092-101.
  • Lee,Y.J. et al., 2008, Cancer Res  68 (18): 7550-60.
  • Hou,Y. et al., 2009, Mol Biol Rep. 36 (8): 2271-7.
  • info info
    添加购物车成功! 添加购物车失败!