After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Human HIST2H2AC natural ORF mammalian expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human HIST2H2AC Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC060324
cDNA-Größe:390bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens histone cluster 2, H2ac DNA.
Synonyme für Gene:H2A, H2A/q, H2AFQ, H2A-GL101
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: HG15213-UT
Listenpreis:   (Save )
Preis:      [How to order]
Verfügbarkeit2-3 weeksAnweisungen für die Lieferung
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“