HIGD1A cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16194-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All HIGD1A Reagents

CRO Services

Product recommended


All HIGD1A Reagents

HIGD1A cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
282 bp
Description
Full length Clone DNA of Human HIG1 hypoxia inducible domain family, member 1A with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIGD1A cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

HIG1 cDNA ORF Clone, Human;RCF1a cDNA ORF Clone, Human

HIGD1A Background Information

Full Name
HIG1 hypoxia inducible domain family, member 1A

HIGD1A cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Canine DG70128-U

HIGD1A cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Rabbit TG65067-G
HIGD1A cDNA ORF Clone, Rabbit, untagged TG65067-UT
HIGD1A Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65067-ACGLN
HIGD1A cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65067-ACG
HIGD1A cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65067-ANG
HIGD1A cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65067-ACR
HIGD1A cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65067-ANR
HIGD1A cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65067-CF
HIGD1A cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65067-NF
HIGD1A cDNA ORF Clone, Rabbit, C-His tag TG65067-CH
HIGD1A cDNA ORF Clone, Rabbit, N-His tag TG65067-NH
HIGD1A cDNA ORF Clone, Rabbit, C-HA tag TG65067-CY
HIGD1A cDNA ORF Clone, Rabbit, N-HA tag TG65067-NY
HIGD1A cDNA ORF Clone, Rabbit, C-Myc tag TG65067-CM
HIGD1A cDNA ORF Clone, Rabbit, N-Myc tag TG65067-NM

HIGD1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Mouse MG51876-G
HIGD1A cDNA ORF Clone, Mouse, untagged MG51876-UT
HIGD1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51876-ACG
HIGD1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51876-ACGLN
HIGD1A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51876-ANG
HIGD1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51876-ACR
HIGD1A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51876-ANR
HIGD1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51876-CF
HIGD1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51876-NF
HIGD1A cDNA ORF Clone, Mouse, C-His tag MG51876-CH
HIGD1A cDNA ORF Clone, Mouse, N-His tag MG51876-NH
HIGD1A cDNA ORF Clone, Mouse, C-HA tag MG51876-CY
HIGD1A cDNA ORF Clone, Mouse, N-HA tag MG51876-NY
HIGD1A cDNA ORF Clone, Mouse, C-Myc tag MG51876-CM
HIGD1A cDNA ORF Clone, Mouse, N-Myc tag MG51876-NM
HIGD1A qPCR Primer Pairs, Mouse MP201749

HIGD1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HIGD1A cDNA ORF Clone in Cloning Vector, Human HG16194-G
HIGD1A cDNA ORF Clone, Human, untagged HG16194-UT
HIGD1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16194-ACGLN
HIGD1A cDNA ORF Clone, Human, C-GFPSpark® tag HG16194-ACG
HIGD1A cDNA ORF Clone, Human, N-GFPSpark® tag HG16194-ANG
HIGD1A cDNA ORF Clone, Human, C-OFPSpark® tag HG16194-ACR
HIGD1A cDNA ORF Clone, Human, N-OFPSpark® tag HG16194-ANR
HIGD1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16194-CF
HIGD1A cDNA ORF Clone, Human, C-His tag HG16194-CH
HIGD1A cDNA ORF Clone, Human, N-His tag HG16194-NH
HIGD1A cDNA ORF Clone, Human, C-HA tag HG16194-CY
HIGD1A cDNA ORF Clone, Human, N-HA tag HG16194-NY
HIGD1A cDNA ORF Clone, Human, C-Myc tag HG16194-CM
HIGD1A cDNA ORF Clone, Human, N-Myc tag HG16194-NM
HIGD1A qPCR Primer Pairs, Human HP104962
info info
添加购物车成功! 添加购物车失败!