After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch Granzyme B/GZMB Gene ORF cDNA clone expression plasmid, C-Flag tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human GZMB Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_004131.3
cDNA-Größe:744bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) with C terminal Flag tag.
Synonyme für Gene:HLP, CCPI, CGL1, CSPB, SECT, CGL-1, CSP-B, CTLA1, CTSGL1
Spezies:Human
Vektor:pCMV3-C-FLAG
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Hintergrund

Granzyme B, also known as GZMB, is the most prominent member of the granzyme family of cell death-inducing serine proteases expressed in the granules of cytotoxic T lymphocytes (CTLs) and NK cells. Granzyme B enters the target cells depending on another membrane-binding granule protein, perforin, results in the activation of effector caspases and mitochondrial depolarization through caspase-dependent and -independent pathways, and consequently induces rapid cell apoptosis. Over 30 substrates of GZMB have been identified including the key substrate caspase-3, ICAD and Bid. GZMB is suggested to protect the host by lysing cells bearing on their surface 'nonself' antigens such as bacterial and viral infected-cells and tumor cells, and accordingly plays an essential role in immunosurveillance.

Size / Price
Katalog: HG10345-CF
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“