After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human GSTM2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000848
cDNA-Größe:657bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens glutathione S-transferase mu 2 (muscle), transcript variant 1 with C terminal His tag.
Synonyme für Gene:GST4
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mensch GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Product nameProduct name
Hintergrund

Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

Referenzen
  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Katalog: HG12042-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“