After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch G6PD Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human G6PD Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000402.3
cDNA-Größe:1638bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens glucose-6-phosphate dehydrogenase.
Synonyme für Gene:G6PD1, G6PD
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-G6PD-t1
Restriktionsschnittstelle:HindIII + XbaI (6.1kb + 1.64kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1401 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human G6PD Gene Plasmid Map
Human G6PD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Katalog: HG12021-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
  • Human G6PD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“