Schnelle Bestellung

Mensch FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch FUOM Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_001098483.1
    cDNA-Größe:465bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens fucose mutarotase with N terminal Flag tag.
    Synonyme für Gene:FUCU, FucM, C10orf125
    Spezies:Human
    Vektor:pCMV3-N-FLAG
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FUOM qPCR primers for gene expression analysis, HP102631 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Mensch FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
    Product nameProduct name
    Hintergrund

    FUOM, also known as fucose mutarotase and FucM, belongs to the RbsD / FucU family. FUOM is involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose has two isforms: alpha-L-fucose (29.5%) and beta-L-fucose (70.5%). The beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes. FUOM mainly exists as homodimer, but also functions as homotetramer, homooctamer, and homodecamer. FUOM's homodimeric form seems catalytically inactive.

    Referenzen
  • Deloukas P. et al., 2004, Nature. 429: 375-81.
  • Ota T. et al., 2004, Nat Genet. 36: 40-5.
  • Dongkyu Park. et al., 2007, Glycobiology. 17 (9): 955-62.
  • Size / Price
    Katalog: HG13974-NF
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“