After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch Fibroblast Activation Protein alpha/FAP Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human FAP Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_004460.2
cDNA-Größe:2283bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens fibroblast activation protein, alpha with C terminal His tag.
Synonyme für Gene:FAPA, DPPIV, DKFZp686G13158, FAP
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mensch Fibroblast Activation Protein alpha/FAP Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Product nameProduct name
Hintergrund

Seprase, also known as 170 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane serine protease and FAP, is a single-pass type II membrane protein which belongs to the peptidase S9B family. Seprase / FAP is found in cell surface lamellipodia, invadopodia and on shed vesicles. Seprase / FAP appears to act as a proteolytically active 170-kDa dimer, consisting of two 97-kDa subunits. It is a member of the group type II integral serine proteases, which includes dipeptidyl peptidase IV ( DPPIV / CD26 ) and related type II transmembrane prolyl serine peptidases, which exert their mechanisms of action on the cell surface. Seprase / FAP colocalized with DPP4 in invadopodia and lamellipodia of migratory activated endothelial cells in collagenous matrix. Seprase / FAP colocalized with DPP4 on endothelial cells of capillary-like microvessels but not large vessels within invasive breast ductal carcinoma. DPP4 and seprase exhibit multiple functions due to their abilities to form complexes with each other and to interact with other membrane-associated molecules. In association with DPP4, Seprase / FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. Seprase / FAP has a dual function in tumour progression. The proteolytic activity of Seprase has been shown to promote cell invasiveness towards the ECM and also to support tumour growth and proliferation. Seprase / FAP may have a role in tissue remodeling during development and wound healing, and may contribute to invasiveness in malignant cancers.

Referenzen
  • Mori,Y. et al., 2004, Oncology. 67 (5-6):411-9.
  • Aertgeerts K., et al., 2005, J. Biol. Chem. 280:19441-19444.
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-2080.
  • Ghersi G., et al., 2006, Cancer Res. 66:4652-4661.
  • O'Brien,P. et al., 2008, Biochim Biophys Acta. 1784 (9):1130-45.
  • Size / Price
    Katalog: HG10464-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“