EZH1 cDNA ORF Clone, Human, N-HA tag

Cat: HG11497-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EZH1 Reagents
CRO Services
Product recommended

All EZH1 Reagents
EZH1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2286 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human enhancer of zeste homolog 1 (Drosophila) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Restriction Sites
KpnI + XbaI(6kb+2.29kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EZH1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EZH1 cDNA ORF Clone, Human, N-HA tag Validated Images
Cynomolgus LOC101926731 Gene Plasmid Map 5628
EZH1 cDNA ORF Clone, Human, N-HA tag Alternative Names
KMT6B cDNA ORF Clone, Human
EZH1 Background Information
Full Name
enhancer of zeste 1 polycomb repressive complex 2 subunit

EZH1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EZH1 cDNA ORF Clone in Cloning Vector, Mouse MG59283-U
EZH1 cDNA ORF Clone, Mouse, untagged MG59283-UT
EZH1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59283-ACG
EZH1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59283-ACGLN
EZH1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59283-ANG
EZH1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59283-ACR
EZH1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59283-ANR
EZH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59283-CF
EZH1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59283-NF
EZH1 cDNA ORF Clone, Mouse, C-His tag MG59283-CH
EZH1 cDNA ORF Clone, Mouse, N-His tag MG59283-NH
EZH1 cDNA ORF Clone, Mouse, C-HA tag MG59283-CY
EZH1 cDNA ORF Clone, Mouse, N-HA tag MG59283-NY
EZH1 cDNA ORF Clone, Mouse, C-Myc tag MG59283-CM
EZH1 cDNA ORF Clone, Mouse, N-Myc tag MG59283-NM

EZH1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EZH1 cDNA ORF Clone in Cloning Vector, Human HG11497-M
EZH1 cDNA ORF Clone, Human, untagged HG11497-UT
EZH1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11497-ACG
EZH1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11497-ACGLN
EZH1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11497-ANG
EZH1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11497-ACR
EZH1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11497-ANR
EZH1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11497-CF
EZH1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11497-NF
EZH1 cDNA ORF Clone, Human, C-His tag HG11497-CH
EZH1 cDNA ORF Clone, Human, N-His tag HG11497-NH
EZH1 cDNA ORF Clone, Human, C-HA tag HG11497-CY
EZH1 cDNA ORF Clone, Human, C-Myc tag HG11497-CM
EZH1 cDNA ORF Clone, Human, N-Myc tag HG11497-NM
EZH1 qPCR Primer Pairs, Human HP101373
info info
添加购物车成功! 添加购物车失败!