EZH1 cDNA ORF Clone, Human, N-HA tag

Cat: HG11497-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All EZH1 Reagents

CRO Services

Product recommended


All EZH1 Reagents

EZH1 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2286 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human enhancer of zeste homolog 1 (Drosophila) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.29kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EZH1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EZH1 cDNA ORF Clone, Human, N-HA tag Validated Images

Cynomolgus LOC101926731 Gene Plasmid Map 5628

EZH1 cDNA ORF Clone, Human, N-HA tag Alternative Names

KMT6B cDNA ORF Clone, Human

EZH1 Background Information

Full Name
enhancer of zeste 1 polycomb repressive complex 2 subunit

EZH1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EZH1 cDNA ORF Clone in Cloning Vector, Mouse MG59283-U
EZH1 cDNA ORF Clone, Mouse, untagged MG59283-UT
EZH1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59283-ACG
EZH1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59283-ACGLN
EZH1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59283-ANG
EZH1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59283-ACR
EZH1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59283-ANR
EZH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59283-CF
EZH1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59283-NF
EZH1 cDNA ORF Clone, Mouse, C-His tag MG59283-CH
EZH1 cDNA ORF Clone, Mouse, N-His tag MG59283-NH
EZH1 cDNA ORF Clone, Mouse, C-HA tag MG59283-CY
EZH1 cDNA ORF Clone, Mouse, N-HA tag MG59283-NY
EZH1 cDNA ORF Clone, Mouse, C-Myc tag MG59283-CM
EZH1 cDNA ORF Clone, Mouse, N-Myc tag MG59283-NM

EZH1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EZH1 cDNA ORF Clone in Cloning Vector, Human HG11497-M
EZH1 cDNA ORF Clone, Human, untagged HG11497-UT
EZH1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11497-ACG
EZH1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11497-ACGLN
EZH1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11497-ANG
EZH1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11497-ACR
EZH1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11497-ANR
EZH1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11497-CF
EZH1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11497-NF
EZH1 cDNA ORF Clone, Human, C-His tag HG11497-CH
EZH1 cDNA ORF Clone, Human, N-His tag HG11497-NH
EZH1 cDNA ORF Clone, Human, C-HA tag HG11497-CY
EZH1 cDNA ORF Clone, Human, C-Myc tag HG11497-CM
EZH1 cDNA ORF Clone, Human, N-Myc tag HG11497-NM
EZH1 qPCR Primer Pairs, Human HP101373
info info
添加购物车成功! 添加购物车失败!