EIF1 cDNA ORF Clone, Human, untagged

Cat: HG16464-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF1 Reagents
CRO Services
Product recommended

All EIF1 Reagents
EIF1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
342 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF1 cDNA ORF Clone, Human, untagged Alternative Names
A121 cDNA ORF Clone, Human;EIF-1 cDNA ORF Clone, Human;EIF1A cDNA ORF Clone, Human;ISO1 cDNA ORF Clone, Human;SUI1 cDNA ORF Clone, Human
EIF1 Background Information
Full Name
eukaryotic translation initiation factor 1

EIF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF1 cDNA ORF Clone in Cloning Vector, Mouse MG52332-U
EIF1 cDNA ORF Clone, Mouse, untagged MG52332-UT
EIF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52332-ACG
EIF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52332-ACGLN
EIF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52332-ANG
EIF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52332-ACR
EIF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52332-ANR
EIF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52332-CF
EIF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52332-NF
EIF1 cDNA ORF Clone, Mouse, C-His tag MG52332-CH
EIF1 cDNA ORF Clone, Mouse, N-His tag MG52332-NH
EIF1 cDNA ORF Clone, Mouse, C-HA tag MG52332-CY
EIF1 cDNA ORF Clone, Mouse, N-HA tag MG52332-NY
EIF1 cDNA ORF Clone, Mouse, C-Myc tag MG52332-CM
EIF1 cDNA ORF Clone, Mouse, N-Myc tag MG52332-NM
EIF1 qPCR Primer Pairs, Mouse MP202205

EIF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF1 cDNA ORF Clone in Cloning Vector, Human HG16464-G
EIF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16464-ACG
EIF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16464-ACGLN
EIF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16464-ANG
EIF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16464-ACR
EIF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16464-ANR
EIF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16464-CF
EIF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16464-NF
EIF1 cDNA ORF Clone, Human, C-His tag HG16464-CH
EIF1 cDNA ORF Clone, Human, N-His tag HG16464-NH
EIF1 cDNA ORF Clone, Human, C-HA tag HG16464-CY
EIF1 cDNA ORF Clone, Human, N-HA tag HG16464-NY
EIF1 cDNA ORF Clone, Human, C-Myc tag HG16464-CM
EIF1 cDNA ORF Clone, Human, N-Myc tag HG16464-NM
EIF1 qPCR Primer Pairs, Human HP105209
info info
添加购物车成功! 添加购物车失败!