After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch ECD / Ecdysoneless homolog Gene ORF cDNA clone expression plasmid, N-Myc tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human ECD Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC000721
cDNA-Größe:1935bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens ecdysoneless homolog (DrosophilA) with N terminal Myc tag.
Synonyme für Gene:GCR2, HSGT1, ECD
Spezies:Human
Vektor:pCMV3-N-Myc
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mensch ECD / Ecdysoneless homolog Gene ORF cDNA clone expression plasmid, N-Myc tag on other vectors
Product nameProduct name
Hintergrund

ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in muscle and heart. ECD is a novel promoter of mammalian cell cycle progression. This function is related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. It is a novel tumor-promoting factor that is differentially expressed in pancreatic cancer and potentially regulates glucose metabolism within cancer cells. ECD may also be a transcriptional activator required for the expression of glycolytic genes.

Referenzen
  • Badzek S. et al., 2011, Wien Klin Wochenschr. 123 (23-24): 726-31.
  • Zhao X. et al., 2012, Breast Cancer Res Treat. 134 (1): 171-80.
  • Dey P. et al., 2012, Clin Cancer Res. 18 (22): 6188-98.
  • Size / Price
    Katalog: HG14311-NM
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“