Schnelle Bestellung

Mensch ARHI / DIRAS3 Gene ORF cDNA clone expression plasmid

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch DIRAS3 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:BC005362
    cDNA-Größe:690bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens DIRAS family, GTP-binding RAS-like 3.
    Synonyme für Gene:ARHI, NOEY2, DIRAS3
    Spezies:Human
    Vektor:pCMV3-untagged
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DIRAS3 qPCR primers for gene expression analysis, HP102889 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Hintergrund

    ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, ARHI is not only an important factor in the pathogenesis of gastric cancer, but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease.

    Referenzen
  • Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24.
  • Lin D. et al., 2011, J Int Med Res. 39 (5): 1870-5.
  • Wang W. et al., 2012, Oncol Rep. 27 (6): 1953-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“