After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human DBH Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC017174
cDNA-Größe:1812bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with N terminal HA tag.
Synonyme für Gene:DBM, DBH
Spezies:Human
Vektor:pCMV3-N-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mensch DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Product nameProduct name
Hintergrund

DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

Referenzen
  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • Size / Price
    Katalog: HG13440-NY
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“