After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human CAMK4 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001744.4
cDNA-Größe:1422bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
Synonyme für Gene:CaMK-GR, MGC36771, CAMK4
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Hintergrund

Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

Referenzen
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Katalog: HG10664-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“