CaMKII alpha cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

CaMKII alpha cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Description
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase II alpha with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CaMKII alpha cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CAMKA cDNA ORF Clone, Human

CaMKII alpha Background Information

Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca2+/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca2+ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.
Full Name
calcium/calmodulin-dependent protein kinase II alpha
References
  • Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.
  • Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.
  • Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.
Add to Cart Successfully Add to Cart Failed