CaMKII alpha cDNA ORF Clone, Human, N-Myc tag

Cat: HG10648-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CaMKII alpha Reagents

CRO Services

Product recommended


All CaMKII alpha Reagents

CaMKII alpha cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Description
Full length Clone DNA of Human calcium/calmodulin-dependent protein kinase II alpha with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CaMKII alpha cDNA ORF Clone, Human, N-Myc tag Alternative Names

CAMKA cDNA ORF Clone, Human

CaMKII alpha Background Information

Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca2+/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca2+ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.

Full Name
calcium/calmodulin-dependent protein kinase II alpha
References
  • Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.
  • Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.
  • Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.
  • CaMKII alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CaMKII alpha cDNA ORF Clone in Cloning Vector, Mouse MG50848-G
    CaMKII alpha cDNA ORF Clone, Mouse, untagged MG50848-UT
    CaMKII alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50848-ACGLN
    CaMKII alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50848-ACG
    CaMKII alpha cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50848-ANG
    CaMKII alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50848-ACR
    CaMKII alpha cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50848-ANR
    CaMKII alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50848-CF
    CaMKII alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50848-NF
    CaMKII alpha cDNA ORF Clone, Mouse, C-His tag MG50848-CH
    CaMKII alpha cDNA ORF Clone, Mouse, N-His tag MG50848-NH
    CaMKII alpha cDNA ORF Clone, Mouse, C-HA tag MG50848-CY
    CaMKII alpha cDNA ORF Clone, Mouse, N-HA tag MG50848-NY
    CaMKII alpha cDNA ORF Clone, Mouse, C-Myc tag MG50848-CM
    CaMKII alpha cDNA ORF Clone, Mouse, N-Myc tag MG50848-NM
    CaMKII alpha qPCR Primer Pairs, Mouse MP200819

    CaMKII alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CaMKII alpha cDNA ORF Clone in Cloning Vector, Human HG10648-M
    CaMKII alpha cDNA ORF Clone, Human, untagged HG10648-UT
    CaMKII alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10648-ACGLN
    CaMKII alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10648-ACG
    CaMKII alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG10648-ANG
    CaMKII alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10648-ACR
    CaMKII alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG10648-ANR
    CaMKII alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10648-CF
    CaMKII alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10648-NF
    CaMKII alpha cDNA ORF Clone, Human, C-His tag HG10648-CH
    CaMKII alpha cDNA ORF Clone, Human, N-His tag HG10648-NH
    CaMKII alpha cDNA ORF Clone, Human, C-HA tag HG10648-CY
    CaMKII alpha cDNA ORF Clone, Human, N-HA tag HG10648-NY
    CaMKII alpha cDNA ORF Clone, Human, C-Myc tag HG10648-CM
    CaMKII alpha qPCR Primer Pairs, Human HP100620
    info info
    添加购物车成功! 添加购物车失败!