Schnelle Bestellung

Mensch CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch CYP2D6 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000106.4
cDNA-Größe:1494bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
Synonyme für Gene:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 1.49kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CYP2D6 qPCR primers for gene expression analysis, HP101558 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: HG12022-UT
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“