CYHR1 cDNA ORF Clone, Human, N-His tag

Cat: HG14584-NH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CYHR1 Reagents

CRO Services

Product recommended


All CYHR1 Reagents

CYHR1 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Human cysteine/histidine-rich 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CYHR1 cDNA ORF Clone, Human, N-His tag Alternative Names

CHRP cDNA ORF Clone, Human

CYHR1 Background Information

Full Name
cysteine/histidine-rich 1

CYHR1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CYHR1 cDNA ORF Clone in Cloning Vector, Rat RG81272-U
CYHR1 cDNA ORF Clone, Rat, untagged RG81272-UT
CYHR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81272-ACGLN
CYHR1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81272-ACG
CYHR1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81272-ANG
CYHR1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81272-ACR
CYHR1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81272-ANR
CYHR1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81272-CF
CYHR1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81272-NF
CYHR1 cDNA ORF Clone, Rat, C-His tag RG81272-CH
CYHR1 cDNA ORF Clone, Rat, N-His tag RG81272-NH
CYHR1 cDNA ORF Clone, Rat, C-HA tag RG81272-CY
CYHR1 cDNA ORF Clone, Rat, N-HA tag RG81272-NY
CYHR1 cDNA ORF Clone, Rat, C-Myc tag RG81272-CM
CYHR1 cDNA ORF Clone, Rat, N-Myc tag RG81272-NM
CYHR1 qPCR Primer Pairs, Rat RP301228

CYHR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CYHR1 cDNA ORF Clone in Cloning Vector, Human HG14584-G
CYHR1 cDNA ORF Clone, Human, untagged HG14584-UT
CYHR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14584-ACGLN
CYHR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14584-ACG
CYHR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14584-ANG
CYHR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14584-ACR
CYHR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14584-ANR
CYHR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14584-CF
CYHR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14584-NF
CYHR1 cDNA ORF Clone, Human, C-His tag HG14584-CH
CYHR1 cDNA ORF Clone, Human, C-HA tag HG14584-CY
CYHR1 cDNA ORF Clone, Human, N-HA tag HG14584-NY
CYHR1 cDNA ORF Clone, Human, C-Myc tag HG14584-CM
CYHR1 cDNA ORF Clone, Human, N-Myc tag HG14584-NM
CYHR1 qPCR Primer Pairs, Human HP103219
info info
添加购物车成功! 添加购物车失败!