After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human CSNK1A1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001892.4
cDNA-Größe:1014bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens casein kinase 1, alpha 1.
Synonyme für Gene:CK1, HLCDGP1, PRO2975, CSNK1A1
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-CSNK1A1
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 1.01kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human CSNK1A1 Gene Plasmid Map
Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid on other vectors
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10668-ACG$225
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10668-ACR$225
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10668-ANG$225
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10668-ANR$225
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-CF$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10668-CH$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10668-CM$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10668-CY$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone in cloning vectorHG10668-M$75
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10668-M-F$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10668-NF$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10668-NH$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10668-NM$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10668-NY$195
Mensch CSNK1A1/Casein Kinase 1, alpha 1 Gene ORF cDNA clone expression plasmidHG10668-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Hintergrund

Casein kinase I isoform alpha, also known as CKI-alpha, CK1 and CSNK1A1, is a cytoplasm protein which belongs to the protein kinase superfamily, CK1 Ser/Thr protein kinase family and casein kinase I subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. High expression of CSNK2A1, or concomitantly high expression of CSNK2A1, are independent prognostic factors of poor survival in NSCLC patients. CSNK2A1 are useful prognosis markers in non-small cell lung cancer (NSCLC) patients after complete resection, independent of lymph node metastasis status. CSNK1A1 can phosphorylate a large number of proteins. It participates in Wnt signaling. It phosphorylates CTNNB1 at 'Ser-45'. CSNK1A1 may play a role in segregating chromosomes during mitosis.

Referenzen
  • Dubois, et al.,2002, FEBS Lett. (Netherlands) 517 (1-3): 167-71. 
  • Dubois, T et al.,2001, J. Biol. Chem.(United States) 276 (22): 18757-64.
  • Zhang, Yi et al., 2002, J. Biol. Chem. 277(20): 17706-12.
  • Wang,Z. et al., 2010, Med Sci Monit.16 (8):CR357-64.
  • Size / Price
    Katalog: HG10668-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Human CSNK1A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“