Schnelle Bestellung

Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch CFLAR Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_003879.4
cDNA-Größe:1443bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens CASP8 and FADD-like apoptosis regulator transcript variant 1 with C terminal His tag.
Synonyme für Gene:CASH, FLIP, MRIT, CLARP, FLAME, Casper, FLAME1, c-FLIP, FLAME-1, I-FLICE, c-FLIPL, c-FLIPR, c-FLIPS, CASP8AP1, CFLAR
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CFLAR qPCR primers for gene expression analysis, HP101025 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11110-ACG$225
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11110-ACR$225
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11110-ANG$225
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11110-ANR$225
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11110-CF$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG11110-CH$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11110-CM$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG11110-CY$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone in cloning vectorHG11110-M$75
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11110-M-F$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11110-NF$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG11110-NH$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11110-NM$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG11110-NY$195
Mensch c-FLIP/FLIP transcript variant 1 Gene ORF cDNA clone expression plasmidHG11110-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: HG11110-CH
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“