After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CEP70 natural ORF mammalian expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human CEP70 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC016050
cDNA-Größe:639bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens centrosomal protein 70kDA.
Synonyme für Gene:BITE, FLJ13036, CEP70
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“