After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch CDKL2 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human CDKL2 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_003948.3
cDNA-Größe:1482bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens cyclin-dependent kinase-like 2 (CDC2-related kinase).
Synonyme für Gene:P56, KKIAMRE, CDKL2
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-CDKL2
Restriktionsschnittstelle:HindIII + XbaI (6.1kb + 1.48kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human CDKL2 Gene Plasmid Map
Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Hintergrund

Cyclin-dependent kinase-like 2 (Cdkl2) is a member of cdc2-related serine / threonine protein kinase family and it is found expressed in various brain regions, including the cerebral cortex, entorinal cortex, hippocampus, amygdala, and dorsal thalamus. The high expression in these brain regions suggests that Cdkl2 may have functions in congnition and emotion processes. Cdkl2 accumulates primarily in the cytoplasm, with lower levels in the nucleus.

Referenzen
  • Sassa T, et al. (2003) Postnatal expression of Cdkl2 in mouse brain revealed by LacZ inserted into the Cdkl2 locus. Cell and Tissue Research. 315 (2): 147-56.
  • Rosenblatt J, et al. (1992) Human cyclin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. PNAS. 89 (7): 2824-8.
  • Mironov V, et al. (1999) Cyclin-Dependent Kinases and Cell Division in Plants-The Nexus. The Plant Cell. 11 (4): 509-22.
  • Size / Price
    Katalog: HG11191-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
    • Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“