Schnelle Bestellung

Mensch CD40/TNFRSF5 transcript variant 2 Gene ORF cDNA clone expression plasmid

  • Human CD40 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch CD40 Produktinformation zum cDNA-Klon
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens CD40 molecule, TNF receptor superfamily member 5.
Synonyme für Gene: p50, Bp50, CDW40, TNFRSF5
Restriktionsschnittstelle:HindIII + XbaI (5.5kb + 0.61kb)
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
( We provide with CD40 qPCR primers for gene expression analysis, HP100097 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch CD40 Gene Plasmid Map
Human CD40 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Immunochemical staining of human CCNF in human brain with rabbit polyclonal antibody (1 µg/mL, formalin-fixed paraffin embedded sections).
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Mensch CD40/TNFRSF5 transcript variant 2 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.
  • Size / Price
    Katalog: HG16492-G-N
    Preis:      (You Save: )
    VerfügbarkeitIn Stock
    Zum Einkaufswagen hinzufügenAnfrage zu Großauftrag

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.