CD147 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10186-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CD147 Reagents

CRO Services

Product recommended


All CD147 Reagents

CD147 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
810 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human basigin (Ok blood group) (BSG), transcript variant 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.86kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD147 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD147 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human CD147/EMMPRIN/Basigin Gene Expression validated Image 1447
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609

CD147 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

5F7 cDNA ORF Clone, Human;Basigin cDNA ORF Clone, Human;CD147 cDNA ORF Clone, Human;EMMPRIN cDNA ORF Clone, Human;M6 cDNA ORF Clone, Human;OK cDNA ORF Clone, Human;TCSF cDNA ORF Clone, Human

CD147 Background Information

CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted from different modes of glycosylation and N-terminal sequence variants. It is a member of the immunoglobulin superfamily with homology to both the immunoglobulin V domain and MHC class II antigen beta-chain. This protein play important roles in variety of events including spermatogenesis, embryo implantation, neural network formation. CD147 induces the production and release of matrix metalloproteinases (MMP) in the surrounding mesenchymal cells and tumor cells, and thereby promotes invasion, metastasis, growth and survival of malignant cells. Furthermore, CD147 also serves as a receptor for extracellular cyclophilinthe and its association with integrins might be important in signal transduction. Recently, CD147 displays increased expression in many cancers, and it has been previously demonstrated to participate in cancer metastasis and progression. Thus, CD147 and its antibody are used as an effective treatment for malignant cancers.
Full Name
basigin (Ok blood group)
References
  • Tang Y, et al. (2004) Tumor-stroma interaction: positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol Cancer Res. 2(2): 73-80.
  • Wilson MC, et al. (2005) Basigin (CD147) is the target for organomercurial inhibition of monocarboxylate transporter isoforms 1 and 4: the ancillary protein for the insensitive MCT2 is EMBIGIN (gp70). J Biol Chem. 280(29): 27213-21.
  • Curtin KD, et al. (2005) Basigin (EMMPRIN/CD147) interacts with integrin to affect cellular architecture. J Cell Sci. 118(Pt 12): 2649-60.
  • Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44. Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44.
  • Seizer P, et al. (2009) EMMPRIN (CD147) is a novel receptor for platelet GPVI and mediates platelet rolling via GPVI-EMMPRIN interaction. Thromb Haemost. 101(4): 682-6.
  • Moonsom S, et al. (2010) A Competitive ELISA for Quantifying Serum CD147: Reduction of Soluble CD147 Levels in Cancer Patient Sera. Hybridoma (Larchmt). 29(1): 45-52.
  • CD147 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90636-G
    CD147 cDNA ORF Clone, Cynomolgus, untagged CG90636-UT
    CD147 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90636-ACG
    CD147 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90636-ACGLN
    CD147 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90636-ACR
    CD147 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90636-CF
    CD147 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90636-NF
    CD147 cDNA ORF Clone, Cynomolgus, C-His tag CG90636-CH
    CD147 cDNA ORF Clone, Cynomolgus, N-His tag CG90636-NH
    CD147 cDNA ORF Clone, Cynomolgus, C-HA tag CG90636-CY
    CD147 cDNA ORF Clone, Cynomolgus, N-HA tag CG90636-NY
    CD147 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90636-CM
    CD147 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90636-NM

    CD147 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Rat RG82193-U
    CD147 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82193-ACGLN

    CD147 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Mouse MG50332-M
    CD147 cDNA ORF Clone, Mouse, untagged MG50332-UT
    CD147 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50332-ACGLN
    CD147 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50332-ACG
    CD147 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50332-ACR
    CD147 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50332-CF
    CD147 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50332-NF
    CD147 cDNA ORF Clone, Mouse, C-His tag MG50332-CH
    CD147 cDNA ORF Clone, Mouse, N-His tag MG50332-NH
    CD147 cDNA ORF Clone, Mouse, C-HA tag MG50332-CY
    CD147 cDNA ORF Clone, Mouse, N-HA tag MG50332-NY
    CD147 cDNA ORF Clone, Mouse, C-Myc tag MG50332-CM
    CD147 cDNA ORF Clone, Mouse, N-Myc tag MG50332-NM
    CD147 qPCR Primer Pairs, Mouse MP200355

    CD147 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Human HG10186-M
    CD147 cDNA ORF Clone, Human, untagged HG10186-UT
    CD147 cDNA ORF Clone, Human, C-GFPSpark® tag HG10186-ACG
    CD147 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10186-ACGLN
    CD147 cDNA ORF Clone, Human, C-OFPSpark® tag HG10186-ACR
    CD147 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10186-NF
    CD147 cDNA ORF Clone, Human, C-His tag HG10186-CH
    CD147 cDNA ORF Clone, Human, N-His tag HG10186-NH
    CD147 cDNA ORF Clone, Human, C-HA tag HG10186-CY
    CD147 cDNA ORF Clone, Human, N-HA tag HG10186-NY
    CD147 cDNA ORF Clone, Human, C-Myc tag HG10186-CM
    CD147 cDNA ORF Clone, Human, N-Myc tag HG10186-NM
    CD147 qPCR Primer Pairs, Human HP100032
    info info
    添加购物车成功! 添加购物车失败!