After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch CALCB / CGPR / Calcitonin 2 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human CALCB Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000728.3
cDNA-Größe:384bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens calcitonin-related polypeptide beta.
Synonyme für Gene:CALC2, CGRP2, CGRP-II, CALCB
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

CALCB, also known as CGPR and calcitonin 2, belongs to the calcitonin family. CALCB is a calcitonin (CT) peptide which may play a role in the mediation of human inflammatory diseases. It is highly expressed in the skin, blood, and cerebrospinal fluid. CGRP immunolabeling (IL) was detected in epidermal keratinocytes at levels that were especially high and widespread in the skin of humans from locations afflicted with postherpetic neuralgia (PHN) and complex region pain syndrome type 1 (CRPS), of monkeys infected with simian immunodeficiency virus, and of rats subjected to L5/L6 spinal nerve ligation, sciatic nerve chronic constriction, and subcutaneous injection of complete Freund's adjuvant. Increased CGRP-IL was also detected in epidermal keratinocytes of transgenic mice with keratin-14 promoter driven overexpression of noggin, an antagonist to BMP-4 signaling. CGPR dilates a variety of vessels including the coronary, cerebral and systemic vasculature.

Referenzen
  • Lambert NA. 2008, Sci Signal. 1 (25): re5.
  • Linscheid P. et al., 2005, Endocrinology. 146 (6): 2699-708.
  • Hou Q. et al., 2011, Pain. 152 (9): 2036-51.
  • Size / Price
    Katalog: HG13283-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit4-5 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“