CA5B cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12285-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CA5B Reagents
CRO Services
Product recommended

All CA5B Reagents
CA5B cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Human carbonic anhydrase VB, mitochondrial with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CA5B cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CA-VB cDNA ORF Clone, Human;MGC39962 cDNA ORF Clone, Human
CA5B Background Information

Carbonic anhydrase 5B, also known as carbonate dehydratase VB, carbonic anhydrase VB, CA-VB and CA5B, is a member of the alpha-carbonic anhydrase family. The strongest expression of CA5B / CA-VB is in heart, pancreas, kidney, placenta, lung, and skeletal muscle. It is not expressed in liver. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CAs show extensive diversity in tissue distribution and in their subcellular localization. CA5B / CA-VB is localized in the mitochondria and shows the highest sequence similarity to the other mitochondrial CA5A / CA-VA. CA5B / CA-VB has a wider tissue distribution than CA5A / CA-VA, which is restricted to the liver. The differences in tissue distribution suggest that the two mitochondrial carbonic anhydrases evolved to assume different physiologic roles. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt). CA5B / CA-VB is inhibited by coumarins, sulfonamide derivatives such as acetazolamide (AZA), saccharin and Foscarnet (phosphonoformate trisodium salt).

Full Name
carbonic anhydrase VB, mitochondrial
References
  • Fujikawa-Adachi K, et al.,1999, J Biol Chem. 274 (30): 21228-33.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Maresca, A.et al., 2009, J. Am. Chem. Soc. 131:3057-3062.
  • info info
    添加购物车成功! 添加购物车失败!