Schnelle Bestellung

Mensch C2orf49 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch C2ORF49 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC001310
cDNA-Größe:699bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens chromosome 2 open reading frame 49.
Synonyme für Gene:asw, C2orf49
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with C2orf49 qPCR primers for gene expression analysis, HP102890 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: HG14240-UT
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“