After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human BPHL ORF mammalian expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human BPHL Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_004332.2
cDNA-Größe:876bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like with N terminal His tag.
Synonyme für Gene:MCNAA, BPH-RP, VACVASE, BPHL
Spezies:Human
Vektor:pCMV3-SP-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Hintergrund

BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

Referenzen
  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • Size / Price
    Katalog: HG13675-NH
    Listenpreis:   (Save )
    Preis:      [How to order]
    Verfügbarkeit
     Anweisungen für die Lieferung
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“