cIAP1 cDNA ORF Clone, Human, N-His tag

Cat: HG11090-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All cIAP1 Reagents
CRO Services
Product recommended

All cIAP1 Reagents
cIAP1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1857 bp
Description
Full length Clone DNA of Human baculoviral IAP repeat-containing 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

cIAP1 cDNA ORF Clone, Human, N-His tag Alternative Names
API1 cDNA ORF Clone, Human;c-IAP1 cDNA ORF Clone, Human;cIAP1 cDNA ORF Clone, Human;Hiap-2 cDNA ORF Clone, Human;HIAP2 cDNA ORF Clone, Human;MIHB cDNA ORF Clone, Human;RNF48 cDNA ORF Clone, Human
cIAP1 Background Information

The cellular inhibitor of apoptosis protein-1 (cIAP1) is a member of the Inhibitor of Apoptosis family proteinsare (IAP) whose members are characterized by a novel domain of about 70 amino acids termed baculoviral IAP repeats (BIRs). The BIR domains of cIAP1 and cIAP2 bind to caspases, the key effector proteases of apoptosis. The IAP protein family which can enhance cell survival are crucial regulators of programmed cell death. Both cIAP1 and cIAP2 are the E3 ubiquitin protein isopeptide ligases for Smac, taking part in promoting cancer survival through functioning as E3 ubiqitin ligases. Removal of cIAP1 by genetic deletion may result in NF-κB signaling activation that induces TNFα production and in killing sensitive tumor cells through enhanced TNF-R1 death-receptor signaling and caspase 8 activation. The substrate-dependent E3 activity of cIAPs is mediated by their RING domains and is dependent on the specific interactions between cIAPs and Smac. cIAP1 and cIAP2 are also reported to be regulators of NF-kB activation upon TNFαtreatment.

Full Name
baculoviral IAP repeat containing 2
References
  • Vince JE, et al. (2007) IAP Antagonists Target cIAP1 to Induce TNF-Dependent Apoptosis. Cell. 131(4): 682-93.
  • Hu SM, et al. et al. (2003) Cellular Inhibitor of Apoptosis 1 and 2 Are Ubiquitin Ligases for the Apoptosis Inducer Smac/DIABLO. The Journal of Biological Chemistry. 278: 10055-60.
  • Imoto I, et al. (2011) Identification of cIAP1 As a Candidate Target Gene within an Amplicon at 11q22 in Esophageal Squamous Cell Carcinomas 1. Cancer Res. 61: 6629.
  • cIAP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    cIAP1 cDNA ORF Clone in Cloning Vector, Mouse MG50761-G
    cIAP1 cDNA ORF Clone, Mouse, untagged MG50761-UT
    cIAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50761-ACGLN
    cIAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50761-ACG
    cIAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50761-ANG
    cIAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50761-ACR
    cIAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50761-ANR
    cIAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50761-CF
    cIAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50761-NF
    cIAP1 cDNA ORF Clone, Mouse, C-His tag MG50761-CH
    cIAP1 cDNA ORF Clone, Mouse, N-His tag MG50761-NH
    cIAP1 cDNA ORF Clone, Mouse, C-HA tag MG50761-CY
    cIAP1 cDNA ORF Clone, Mouse, N-HA tag MG50761-NY
    cIAP1 cDNA ORF Clone, Mouse, C-Myc tag MG50761-CM
    cIAP1 cDNA ORF Clone, Mouse, N-Myc tag MG50761-NM
    cIAP1 qPCR Primer Pairs, Mouse MP200735

    cIAP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    cIAP1 cDNA ORF Clone in Cloning Vector, Human HG11090-U
    cIAP1 cDNA ORF Clone, Human, untagged HG11090-UT
    cIAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11090-ACG
    cIAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11090-ACGLN
    cIAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11090-ANG
    cIAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11090-ACR
    cIAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11090-ANR
    cIAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11090-CF
    cIAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11090-NF
    cIAP1 cDNA ORF Clone, Human, C-His tag HG11090-CH
    cIAP1 cDNA ORF Clone, Human, C-HA tag HG11090-CY
    cIAP1 cDNA ORF Clone, Human, N-HA tag HG11090-NY
    cIAP1 cDNA ORF Clone, Human, C-Myc tag HG11090-CM
    cIAP1 cDNA ORF Clone, Human, N-Myc tag HG11090-NM
    cIAP1 qPCR Primer Pairs, Human HP101007
    info info
    添加购物车成功! 添加购物车失败!