BBS4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10497-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All BBS4 Reagents

CRO Services

Product recommended


All BBS4 Reagents

BBS4 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1560 bp
Description
Full length Clone DNA of Human Bardet-Biedl syndrome 4 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BBS4 Background Information

Full Name
Bardet-Biedl syndrome 4

BBS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BBS4 cDNA ORF Clone in Cloning Vector, Mouse MG50776-G
BBS4 cDNA ORF Clone, Mouse, untagged MG50776-UT
BBS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50776-ACG
BBS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50776-ACGLN
BBS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50776-ANG
BBS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50776-ACR
BBS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50776-ANR
BBS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50776-CF
BBS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50776-NF
BBS4 cDNA ORF Clone, Mouse, C-His tag MG50776-CH
BBS4 cDNA ORF Clone, Mouse, N-His tag MG50776-NH
BBS4 cDNA ORF Clone, Mouse, C-HA tag MG50776-CY
BBS4 cDNA ORF Clone, Mouse, N-HA tag MG50776-NY
BBS4 cDNA ORF Clone, Mouse, C-Myc tag MG50776-CM
BBS4 cDNA ORF Clone, Mouse, N-Myc tag MG50776-NM
BBS4 qPCR Primer Pairs, Mouse MP200750

BBS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BBS4 cDNA ORF Clone in Cloning Vector, Human HG10497-M
BBS4 cDNA ORF Clone, Human, untagged HG10497-UT
BBS4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10497-ACG
BBS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10497-ACGLN
BBS4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10497-ANG
BBS4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10497-ACR
BBS4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10497-ANR
BBS4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10497-CF
BBS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10497-NF
BBS4 cDNA ORF Clone, Human, C-His tag HG10497-CH
BBS4 cDNA ORF Clone, Human, N-His tag HG10497-NH
BBS4 cDNA ORF Clone, Human, C-HA tag HG10497-CY
BBS4 cDNA ORF Clone, Human, N-HA tag HG10497-NY
BBS4 cDNA ORF Clone, Human, C-Myc tag HG10497-CM
BBS4 qPCR Primer Pairs, Human HP100518
info info
添加购物车成功! 添加购物车失败!