ATP6V1F cDNA ORF Clone, Human, C-HA tag

Cat: HG15605-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ATP6V1F Reagents

CRO Services

Product recommended


All ATP6V1F Reagents

ATP6V1F cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
360 bp
Description
Full length Clone DNA of Human ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V1F cDNA ORF Clone, Human, C-HA tag Alternative Names

ATP6S14 cDNA ORF Clone, Human;VATF cDNA ORF Clone, Human;Vma7 cDNA ORF Clone, Human

ATP6V1F Background Information

ATP6V1F encodes a component of vacuolar ATPase mediating acidification. The cDNA and the genomic sequences of ATP6V1F were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription polymerase chain reaction and touchdown-polymerase chain reaction, respectively. Topology prediction showed that there is one protein kinase C phosphorylation site, two Casein kinase II phosphorylation sites, and one N-myristoylation site in the ATP6V1F protein. Up-regulated expression of mammary tumor 8 kDa protein (MAT-8), complement component C1S (C1S), ferritin heavy chain (FTH1), peptidyl-prolyl cis-trans isomerase A (PPIA), RNA-binding protein regulatory subunit DJ-1 protein (DJ-1) and vacuolar ATP synthase subunit F (ATP6V1F) was determined in prostate carcinoma and confirmed by using quantitative real-time RT-PCR analyses.
Full Name
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F

ATP6V1F cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V1F cDNA ORF Clone in Cloning Vector, Rat RG81686-G
ATP6V1F cDNA ORF Clone, Rat, untagged RG81686-UT
ATP6V1F cDNA ORF Clone, Rat, C-GFPSpark® tag RG81686-ACG
ATP6V1F Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81686-ACGLN
ATP6V1F cDNA ORF Clone, Rat, N-GFPSpark® tag RG81686-ANG
ATP6V1F cDNA ORF Clone, Rat, C-OFPSpark® tag RG81686-ACR
ATP6V1F cDNA ORF Clone, Rat, N-OFPSpark® tag RG81686-ANR
ATP6V1F cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81686-CF
ATP6V1F cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81686-NF
ATP6V1F cDNA ORF Clone, Rat, C-His tag RG81686-CH
ATP6V1F cDNA ORF Clone, Rat, N-His tag RG81686-NH
ATP6V1F cDNA ORF Clone, Rat, C-HA tag RG81686-CY
ATP6V1F cDNA ORF Clone, Rat, N-HA tag RG81686-NY
ATP6V1F cDNA ORF Clone, Rat, C-Myc tag RG81686-CM
ATP6V1F cDNA ORF Clone, Rat, N-Myc tag RG81686-NM

ATP6V1F cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP6V1F cDNA ORF Clone in Cloning Vector, Human HG15605-G
ATP6V1F cDNA ORF Clone, Human, untagged HG15605-UT
ATP6V1F Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15605-ACGLN
ATP6V1F cDNA ORF Clone, Human, C-GFPSpark® tag HG15605-ACG
ATP6V1F cDNA ORF Clone, Human, N-GFPSpark® tag HG15605-ANG
ATP6V1F cDNA ORF Clone, Human, C-OFPSpark® tag HG15605-ACR
ATP6V1F cDNA ORF Clone, Human, N-OFPSpark® tag HG15605-ANR
ATP6V1F cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15605-CF
ATP6V1F cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15605-NF
ATP6V1F cDNA ORF Clone, Human, C-His tag HG15605-CH
ATP6V1F cDNA ORF Clone, Human, N-His tag HG15605-NH
ATP6V1F cDNA ORF Clone, Human, N-HA tag HG15605-NY
ATP6V1F cDNA ORF Clone, Human, C-Myc tag HG15605-CM
ATP6V1F cDNA ORF Clone, Human, N-Myc tag HG15605-NM
ATP6V1F qPCR Primer Pairs, Human HP104224
info info
添加购物车成功! 添加购物车失败!