After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Human ARSB ORF mammalian expression plasmid, N-His tag

DatenblattBesondere ReferenzenBewertungenÄhnliche ProdukteProtokolle
ARSBProduktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000046.3
cDNA-Größe:1602bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens arylsulfatase B with N terminal His tag.
Synonyme für Gene:ASB, G4S, MPS6, ARSB
Spezies:Human
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Other ARSB Protein Products
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Size / Price
Katalog:HG13674-NH
Listenpreis: $315.00  (Save $0.00)
Preis:$315.00      [How to order]
N2-3 weeks
Bilder
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“