Aquaporin 1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14049-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Aquaporin 1 Reagents

CRO Services

Product recommended


All Aquaporin 1 Reagents

Aquaporin 1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
810 bp
Description
Full length Clone DNA of Human aquaporin 1 (Colton blood group) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aquaporin 1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

AQP-CHIP cDNA ORF Clone, Human;CHIP28 cDNA ORF Clone, Human;CO cDNA ORF Clone, Human

Aquaporin 1 Background Information

Aquaporins (AQPs) are a family of hydrophobic integral membrane proteins that function as transmembrane channels and play an important role in tissue homeostasis. Aquaporin-1 (AQP1), in particular, has been reported to be involved in several biological processes including inflammation, angiogenesis, wound healing and others. Aquaporin-1 (AQP1) is expressed in the heart and it has been reported to transport nitric oxide (NO), an important regulator of cardiac function. AQP1 may be a useful diagnosis and prognosis marker for osteosarcoma. AQP1 knockdown can effectively inhibit cell proliferation, adhesion, invasion and tumorigenesis by targeting TGF-beta signaling pathway and focal adhesion genes, which may serve a promising therapeutic strategy for osteosarcoma. AQP1 plays an important role in gastric adenocarcinoma and may therefore represent a novel therapeutic target and prognostic marker in this disease. Malignant pleural mesothelioma (MPM) is an aggressive cancer. MPM cells express aquaporin-1 (AQP1) that in other cancers has been shown to participate in the tumor metastasis processes. AQP1 is expressed in atherosclerotic lesion neovasculature in human and mouse arteries and AQP1 deficiency augments lesion development in ANGII-promoted atherosclerosis in mice. Normal function of AQP1 affords cardiovascular protection. AQP1 effectively downregulated AQP1 expression at the mRNA and protein levels, markedly suppressed cell viability, migration and invasion and promoted apoptosis of ovarian cancers cells. These results suggested that AQP1 may serve as a novel target for ovarian cancer treatment in the future.
Full Name
aquaporin 1 (Colton blood group)

Aquaporin 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Aquaporin 1 cDNA ORF Clone in Cloning Vector, Mouse MG53065-G
Aquaporin 1 cDNA ORF Clone, Mouse, untagged MG53065-UT
Aquaporin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53065-ACG
Aquaporin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53065-ACGLN
Aquaporin 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53065-ANG
Aquaporin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53065-ACR
Aquaporin 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53065-ANR
Aquaporin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53065-CF
Aquaporin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53065-NF
Aquaporin 1 cDNA ORF Clone, Mouse, C-His tag MG53065-CH
Aquaporin 1 cDNA ORF Clone, Mouse, N-His tag MG53065-NH
Aquaporin 1 cDNA ORF Clone, Mouse, C-HA tag MG53065-CY
Aquaporin 1 cDNA ORF Clone, Mouse, N-HA tag MG53065-NY
Aquaporin 1 cDNA ORF Clone, Mouse, C-Myc tag MG53065-CM
Aquaporin 1 cDNA ORF Clone, Mouse, N-Myc tag MG53065-NM

Aquaporin 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Aquaporin 1 cDNA ORF Clone in Cloning Vector, Human HG14049-G
Aquaporin 1 cDNA ORF Clone, Human, untagged HG14049-UT
Aquaporin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14049-ACG
Aquaporin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14049-ACGLN
Aquaporin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14049-ACR
Aquaporin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14049-CF
Aquaporin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14049-NF
Aquaporin 1 cDNA ORF Clone, Human, C-His tag HG14049-CH
Aquaporin 1 cDNA ORF Clone, Human, N-His tag HG14049-NH
Aquaporin 1 cDNA ORF Clone, Human, C-HA tag HG14049-CY
Aquaporin 1 cDNA ORF Clone, Human, N-HA tag HG14049-NY
Aquaporin 1 cDNA ORF Clone, Human, C-Myc tag HG14049-CM
Aquaporin 1 qPCR Primer Pairs, Human HP102705
info info
添加购物车成功! 添加购物车失败!