After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Human AP2M1 natural ORF mammalian expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human AP2M1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC004996.1
cDNA-Größe:1308bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens adaptor-related protein complex 2, mu 1 subunit.
Synonyme für Gene:mu2, AP50, CLAPM1
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-AP2M1
Restriktionsschnittstelle:HindIII + NotI (6.1kb + 1.31kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Katalog: HG16144-UT
Listenpreis:   (Save )
Preis:      [How to order]
VerfügbarkeitIn Stock Anweisungen für die Lieferung
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“